Table of contents:

FASTA format General considerations geneid command line options geneid output formats Samples INDEX

FASTA format:

geneid is only able to read DNA sequences written in FASTA format: Fasta sequence files show this structure: >NAME OR IDENTIFIER OF SEQUENCE ATCGTACAGCTAGCTAGCTACGTACG TCGTACGATCGATCGTAGCATCACGA GGTCAGCATCTAGCACATCACACAGC CTATCAGCTAGCATCGATCGCATCGA ... Usually Fasta lines are 60 chars long but this is not mandatory.

General considerations:

To run geneid, type geneid [options] sequence_file where sequence_file is a FASTA formatted DNA sequence. Predictions are sent to the standard output. In addition, the program requires an organism specific parameters file (which can be broadly used within the phylogenetic group to which organism belongs. For instance, the human file may be used as well to predict genes in genomic sequences from vertebrates).The directory params contains several files for different organisms. The parameters file may be speficied in three different ways: By default, geneid will try to find a default file called param.default which must be in the same directory that the binary. Through the enviromental var GENEID, defining the path. Using the command line option geneid -P file.

geneid command line options:

Selection of genomic elements to display Flag Action b Display best Start codons found on sequence d Display best Donor sites found on sequence a Display best Acceptor sites found on sequence e Display best Stop codons found on sequence f Display best First exons found on sequence i Display best Internal exons found on sequence t Display best Terminal exons found on sequence s Display best Single genes found on sequence x Display best exons (all) found on sequence z Display Open Reading Frames found on sequence [see -Z] D Display genomic sequence in predicted genes Selection of output format Flag Action - geneid format G gff format X Extended format (gff or geneid) M XML output (see -m) m See DTD for XML output Control prediction engine Flag Action - Predictions in both strands of sequence W Predictions only in forward strand of sequence C Predictions only in reverse strand of sequence o Only signal and exon prediction (gene assembling disabled) O Only gene assembling (exons provided from file) Z Switch ORF searching on Re-annotation of sequences Flag Action R Include annotations (evidences) provided from file S Use homology to protein information (SR) provided from file Statistical model Flag Action P Provide a new parameter file E Increase/decrease exon weight value Miscellanea Flag Action v Display information during geneid running h Show list of available options

geneid output formats:

Click over every available format to see a detailed description: geneid format (default) gff format xml format extended format (geneid and gff formats)

Samples:

Click over every example to see the corresponding output: Prediction of acceptor splice sites Prediction of exons Gene prediction Improving gene prediction by using re-annotation Improving gene prediction by using homology information This the sequence used to generate these outputs: test.fa

Enrique Blanco Garcia © 2001