| Gene extracted from a human prediction (geneid eXtended format) | 
| 
# Gene 7 (Reverse). 3 exons. 476 aa. Score = 47.504540
    Stop    91832    91834       0.00   -       ATAA
Terminal    91832    92551      30.56   - 0 0   0.00  3.93   84.26  0.00   AA 237:476 gene_7
Acceptor    92551    92552       3.93   -       GCGGTGGTGCGGCTGTCCCCGCAGGTG
   Donor    93982    93983       1.23   -       AAGGTATCT
Internal    93983    94263       9.83   - 2 0   1.23  2.79   32.30  0.00   AA 143:236 gene_7
Acceptor    94263    94264       2.79   -       AGCTGTGAACTGTTTGTTTGCTAGGGT
   Donor    95208    95209       2.52   -       AAGGTAACC
   First    95209    95635       7.11   - 0 1   2.52  -1.55  30.08  0.00   AA   1:143 gene_7
   Start    95633    95635      -1.55   -       TTTAGAAAGCTGAGATGATG
>L1084|geneid_v1.1_predicted_protein_7|476_AA
MMERIRKEMILMERGLHSPTAGKRFSSLSDSAGGAVLEALENSQHPARLSPRLPSAPLHG
ALGDLPAKGKFEIDTLFNLQHPSSESTVSSEIASATESRKKPSHYSEAAAEADMSSDVEV
GCSALRSPSGLGAAPLKENNAKGYTESGSVAGTTTSASGSGLGSLHGGGGGGNSGAAALG
GSGSGSGADQVRRYRTAFTREQIARLEKEFYRENYVSRPRRCELAAALNLPETTIKVWFQ
NRRMKDKRQRLAMSWPHPADPSFYTYMMTHAAATGSLPYPFHSHVPLHYYPHVGVTAAAA
AAAASGAAAAASSPFATSIRPLDTFRALSHPYSRPELLCSFRHPGLYQAPAAAAGLNSAA
SAAAAAAAAAAAASSAAAAGAPPSGSSAPCSCLSCHSSQSAAAAAAAAAAALGSRGGGGS
GGGGGGGAGTAGGSDFGCSAAAPRSESGFLPYSAAVLSKTAVSPPDQRDEAPLTR*
 | 
| Description of columns (geneid eXtended format) | |
| Exon type | Type of predicted exon: First, Internal, Terminal or Single | 
| Signal type | Type of predicted signal: Acceptor, Donor, Start or Stop codon | 
| Positions | Start and finish positions of current exon and signals | 
| Score | Score (reliability) of exon and signals | 
| Strand | Reading sense: forward or reverse | 
| Frame | Left uncomplete codon length in this exon | 
| Remainder | Right uncomplete codon length in this exon | 
| Partial scores (exons): | Scores (log likelihood) from: 
 | 
| AA | Amino acids corresponding to the exon translation | 
| Key | Gene identifier | 
Enrique Blanco Garcia © 2001