Genefinding: running a program on your computer

Try the next steps:

1. Connect to the GBL web.
   

2. Select Software
   

3. Select geneid and then, geneid homepage
   

4. Take a look around the page to answer these questions...:

   • If you have problems with the program, what can you do?
   • Imagine you would like to see any example of geneid output before testing it, you should go to...
   • You are going to download the program, what do you have to do?

   
   

5. Let's download the program:

   • Get the geneid v 1.1. Full distribution (save the file geneid_v1.1.Feb_26_2003.tar.gz)
     

   • The file is compressed, try on your terminal:
     tar -zxvf geneid_v1.1.Feb_26_2003.tar.gz
     

   • Type cd geneid, and then make
     

   • Type:   bin/geneid -h
     

   • Take a look at the list of options
     

   • Save the sequence on your directory: HS307871.fa
     

   • Run the gene prediction:
     bin/geneid -P param/human3iso.param HS307871.fa
     

   • Add the option -v and try to discover how it works
     

   • Compare the prediction to the annotated gene
     

6. Reannotation from experimental results:
   From the first practice, you have observed a lack of accuracy when predicting the first exon of the gene (1107..1126).

   • Can you verify whether geneid is actually building this exon or not by running geneid to predict exons? (hint: look for the option to do it)
     

   • The solution for the previous step was:
     bin/geneid -xGP param/human3iso.param HS307871.fa | grep 1107
     

   • Let's imagine this exon has been experimentally tested and then, we'll try to rebuild the prediction with it. Take a look at this exon.
     

   • Reannotation process. Type and analyze the current solution:
     bin/geneid -P param/human3iso.param -R exon.gff HS307871.fa
     

7. Advantages of working in a Unix like system
   Using geneid in command line together with some Unix programs (grep, wc, gawk, sort, ...), we can easily parse geneid output to answer the following questions:
   

   • A - How many putative exons does geneid predict on this sequence ?
     

   • B - And how many putative acceptors sites ?
     

   • C - Which is the start codon with the highest score between the coordinates 500 and 1500 ?
     

   • D - How many putative exons does geneid predict that contain the GGGGG motive at aminoacid level?
     

   • E - Which is the longest Single exon gene predicted by geneid ? And the shortest ?
     

## Solutions: A bin/geneid -xoP param/human3iso.param HS307871.fa | grep -v "#" | wc 3612 B bin/geneid -oaP param/human3iso.param HS307871.fa | grep -v "#" | wc 368 C bin/geneid -obP param/human3iso.param HS307871.fa | gawk '{if ($2>500 && $3<1550) print}' | sort +3n Start 998 1000 3.87 - CCAAGAGCGTCGCCATGTTG D bin/geneid -oxP param/human3iso.param HS307871.fa | grep GGGGG | wc 18 E bin/geneid -osP param/human3iso.param HS307871.fa | sort +11n Single 2104 2163 -6.26 - 0 0 0.00 -1.75 -0.51 0.00 20 Single 827 1174 -7.24 + 0 0 -1.27 0.00 -3.70 0.00 116

Josep F. Abril, Enrique Blanco, Sergi Castellano, Genis Parra and Roderic Guigó © 2002